• Способы выделения у животных


    О.К.№30.Выделение у животных

    3

    Выделение у животных.

    О.К. № 30. Биология.

    7 класс.

    Выделение животныхсовокупность процессов, которые осуществляются с помощью специальных органов и обеспечивают выведение из организма излишка воды, конечных продуктов обмена, солей и ядовитых веществ, которые попали в организм или образовались в нем.

    Из организма животных выделяются разные вещества. Среди них есть и такие, которые в случае накопления вызывают нарушения нормальной жизни животных:

    1. Конечные продукты окисления (углекислый газ, вода)

    2. Излишек воды и солей

    3. Ядовитые вещества, которые попали в организм с едой или образовались во время реакций (например, синильная кислота, алкалоиды)

    4. Конечные продукты обмена белков (это азотсодержащие вещества – аммиак, мочевина, мочевая кислота)

    5. Чужеродные вещества (например, ядохимикаты)

    У животных, которые еще не имеют настоящих тканей и органов (губки, кишечнополостные), выделение продуктов обмена осуществляется на уровне клеток через их мембраны с помощью сократительных вакуолей.

    У всех остальных животных в этом принимают участие разные органы.

    Первую группу образуют органы, которые специализируются на выделениипротонефридии, зеленые железы, метанефридии, выделительные трубочки, почки. Специализированные органы выделяют мочужидкость с растворенными веществами.

    К другой группе относят органы дыхательной, пищеварительной и покровной систем, которые, кроме своих функций, осуществляют еще и выделительную. Так, жабры и легкие удаляют углекислый газ, кишечникнепереваренные остатки, кожасоли, мочевину.

    Для чего нужно такое разнообразие органов «поддержки чистоты организма»?

    Выделение обеспечивает такое важное для организма свойство, как постоянство условий внутренней среды – гомеостаз.

    У животных, которые живут в разных условиях существования система выделения выполняет разные функции: выделяется излишек солей у морских обитателей и излишек воды у пресноводных, экономится вода у обитателей засушливых местностей, быстро избавляются от лишней влаги подвижные животные.

    Эволюция выделительной системы:

    • У губок и кишечнополостных таких органов нет и выделение из организма конечных продуктов обмена осуществляется путем диффузии через поверхность тела.

    • У плоских червей появились протонефридии - это разветвленная трубочка, которая открывается на поверхность тела порой.

    • У кольчатых червей, которые ведут водный образ жизни, функционируют метанефридии - трубки, которые одним концом открываются в полость, а противоположным концом – наружу.

    • У наземных беспозвоночных (паукообразные и насекомые) являются выделительные трубочки (мальпигиевы сосуды) количеством от двух до нескольких сотен. Каждый сосуд открывается в кишечник на границе средней и задней кишки, а другой конец слепо замкнут и омывается гемолимфой.

    • У позвоночных животных органами выделения являются парные почки, которые расположены в брюшной полости около позвоночника. Каждая почка состоит из тысячи почечных элементов, которые тесно связаны кровеносными сосудами. Канальцы от этих элементов собирают мочу и направляют ее к парным мочеточникам, по которым моча попадает в мочевой пузырь, который открывается наружу мочеиспускательным каналом. У большинства позвоночных животных органы выделения образуют

    Мочевыделительная система у позвоночных животных - мочевыводящие пути (мочеточники, мочевой пузырь, мочеиспускательный канал) и органы образования мочи (почки).

    Деятельность специализированных органов выделения связана с процессами фильтрации и обратного всасывания. Так, к почкам подходит кровь, которая содержит растворенные вещества для удаления из организма. Кровь фильтруется с образованием мочи, из которой благодаря всасыванию возвращаются в организм полезные вещества.

    Моча продукт жизнедеятельности животных, который образуется почками благодаря процессам фильтрации и секреции.

    Своеобразной формой выделения является превращение в нерастворимую форму вредных веществ, которое осуществляется в специальных клетках тела. Например, жировое тело у насекомых имеет клетки, способные накапливать и изолировать мочевую кислоту.

    Важное место в «очищении» организма принадлежит печени, которая способна превращать определенные ядовитые вещества в безвредные для организма. Синтез мочевины в клетках печени – основной путь обезвреживания ядовитого аммиака у всех позвоночных животных.

    Таким образом, можно назвать три основные формы выделения:

    1. Растворение продуктов обмена и удаление их с мочой

    2. Изоляция продуктов обмена

    3. Превращение продуктов обмена в безвредные

    У водных животных в моче преобладает легкорастворимый аммиак, у водно-наземныхмочевина, у наземных – плохо растворимая мочевая кислота. Поэтому всех животных делят на три такие группы:

    1. Животные, которые выделяют аммиак (большинство беспозвоночных, пресноводные костные рыбы)

    2. Животные, которые выделяют мочевину (хрящевые рыбы, морские костные рыбы, амфибии, млекопитающие)

    3. Животные, которые выделяют мочевую кислоту (насекомые, рептилии, птицы)

    Упражнение 1. Сопоставьте органы выделения с группами животных и их представителями.

    1. Протонефридии

    А. Кольчатые черви

    а Махаон

    1. Метанефридии

    Б. Позвоночные

    б Планарии

    1. Зеленые железы

    В. Ракообразные

    в Медицинская пиявка

    1. Мальпигиевы сосуды

    Г. Насекомые

    г Морской лев

    1. Почки

    Д. Плоские черви

    д Лангуст

    Упражнение 2.

    Опишите способы выделения изображенных животных, назвав: 1) тип органов выделения; 2) пути выделения; 3) группу животных по азотсодержащему продукту выделения.

    А

    Оценка

    Вопросы для самоконтроля

    1-6

    1.Что такое выделение?

    2. Приведите примеры веществ, которые выводятся из организма животных.

    3. Назовите основные типы органов выделения животных.

    4. Какое основное значение выделения у животных?

    5. Назовите формы выделения у животных.

    6. Какие органы выделения у позвоночных животных?

    7-9

    7.Какое значение имеет выделение для организма животных?

    8. Какие типы органов выделения есть у животных?

    9. Какие формы выделения есть у животных?

    10-12

    10. Опишите способы выделения на примере конкретных животных.

    Экстракция ДНК


    Создано Джорджем Райсом, Государственный университет Монтаны


    Рассел Хилл инструктирует студентов по извлечению ДНК на курсе SMaRT 2005 года. (изображение предоставлено Russell Hill, 2005 г.) Что такое экстракция ДНК?

    Проще говоря, экстракция ДНК - это удаление дезоксирибонуклеиновой кислоты (ДНК) из клеток или вирусов, в которых она обычно находится.

    Для чего это используется?

    Извлечение ДНК часто является ранним этапом многих диагностических процессов, используемых для обнаружения бактерий и вирусов в окружающей среде, а также для диагностики заболеваний и генетических нарушений.Эти методы включают, но не ограничиваются:

    • Флуоресцентная гибридизация in situ (FISH): FISH - это молекулярный метод, который используется, среди прочего, для идентификации и подсчета конкретных бактериальных групп.
    • Полиморфизм длины конечного рестрикционного фрагмента (T-RFLP): T-RFLP используется для идентификации, характеристики и количественной оценки пространственных и временных закономерностей в сообществах морского бактериопланктона.
    • Секвенирование: могут быть секвенированы части или целые геномы, а также дополнительные хромосомные элементы для сравнения с существующей последовательностью в общедоступной базе данных.


    Как это работает?

    Схема базовой экстракции ДНК -

    1. Взломайте (лизируйте) клетки или вирус, содержащие интересующую ДНК -
      Это часто делается обработкой ультразвуком или взбиванием образца шариками. Перемешивание с фенолом (иногда нагретым) часто эффективно для разрушения прочных клеточных стенок или вирусных капсидов. Добавление детергента, такого как SDS, часто необходимо для удаления липидных мембран.
    2. ДНК-ассоциированные белки, как и другие клеточные белки, могут разрушаться при добавлении протеазы.Осаждению белка способствует добавление соли, такой как ацетат аммония или натрия. Когда образец встряхивают с фенол-хлороформом и центрифугируют, белки остаются в органической фазе, и их можно осторожно отобрать. ДНК будет находиться на границе между двумя фазами.
    3. ДНК
    4. осаждают путем смешивания с холодным этанолом или изопропанолом и последующего центрифугирования. ДНК нерастворима в спирте и выходит из раствора, а спирт служит промывкой для удаления ранее добавленной соли.
    5. Снова промойте полученный осадок ДНК холодным спиртом и центрифугируйте для извлечения осадка.
    6. После слива спирта с осадка и сушки ДНК можно повторно суспендировать в буфере, таком как Трис или ТЕ.
    7. Наличие ДНК может быть подтверждено электрофорезом на агарозном геле, содержащем бромид этидия или другой флуоресцентный краситель, который реагирует с ДНК, и проверкой в ​​УФ-свете.

    Изображение вирусной ДНК, подвергнутой электрофорезу в агарозном геле.ДНК экстрагировали из теплового вируса STIV и разрезали тремя отдельными рестрикционными ферментами. (рисунок предоставлен автором)

    Инструменты, используемые для экстракции ДНК - Это устройство для взбивания гранул используется для разрушения или «лизиса» клеток на ранних этапах экстракции, чтобы сделать ДНК доступной. Стеклянные шарики добавляют в пробирку эппендорфа, содержащую интересующий образец, и взбиватель для шариков энергично вибрирует раствор, заставляя стеклянные шарики физически разрушать клетки.Другие методы, используемые для лизиса клеток, включают френч-пресс и устройство для обработки ультразвуком. Центрифуга , такая как эта, может вращаться со скоростью до 15000 об / мин для облегчения разделения различных фаз экстракции. Он также используется для осаждения ДНК после смывания солей этанолом и / или изопропанолом. Коробка с гелем используется для разделения ДНК в агарозном геле с электрическим зарядом. Когда красный и черный провода подключены к источнику питания, ДНК мигрирует через гель в сторону положительного заряда из-за чистого отрицательного заряда молекулы.Части ДНК разного размера движутся с разной скоростью, при этом более крупные части движутся медленнее через пористую среду, тем самым создавая разделение по размеру, которое можно различить в геле.

    Ссылки по теме


    • Справочная страница, дающая обзор ДНК и важности этой молекулы в современной молекулярной биологии.

    Преподавательская деятельность


    • Серия лабораторных упражнений с инструкциями по выделению ДНК из нескольких различных исходных материалов.Упражнение рассчитано на учащихся 6–12 классов.
    Следующие ресурсы были первоначально доступны через коллекцию цифровых ресурсов BioSciEd Net (BEN), которая представляет собой путь Национальной научной цифровой библиотеки (NSDL) для образования в области биологических наук. Дополнительные учебные ресурсы можно найти на сайте BEN, чтобы использовать их базу данных с возможностью поиска. BEN можно использовать бесплатно, но требуется регистрация.
    • Выделение ДНК из лука - Эта лаборатория от AccessExcellence позволяет студентам конкретно работать с ДНК, легко выделяя хромосомную ДНК с помощью тех же основных инструментов и методов, которые используют ученые.
    • Извлечение ДНК - этот веб-сайт Science NetLinks предлагает планы уроков, которые развивают понимание ДНК путем моделирования процесса извлечения ДНК.
    • [ссылка https://web.archive.org/web/20190222033127/http://www.apsnet.org/edcenter/K-12/TeachersGuide/DNA_Easy/Pages/default.aspx «Легкий путь ДНК (и Грамм Пятно без беспорядка »] - этот ресурс Американского фитопатологического общества представляет собой короткое лабораторное упражнение, которое обучает студентов процедурам выделения ДНК из бактериальных клеток.Кроме того, студенты узнают, как определять реакцию бактериальных изолятов окрашиванием по Граму.
    • ДНК-детективы: этот ресурс Access Excellence предоставляет лабораторные занятия, где студенты используют анализ ДНК-отпечатков пальцев для определения виновника фиктивного преступления.
    • Используйте ПЦР и один волос для получения отпечатка ДНК - этот ресурс требует, чтобы вы вошли в систему BEN для просмотра (для этого требуется подписка на BEN, которая является бесплатной). Этот документ в формате PDF предлагает подробное руководство по протоколам и инструктивную информацию для выполнения студентами лабораторных занятий по молекулярной биологии и ценетике, в которых студенты используют полимеразную цепную реакцию для создания отпечатков пальцев ДНК из своих собственных волос.Он включает в себя конспекты студентов, заметки инструктора и предлагаемые вопросы для лабораторных отчетов.
    .

    Польза домашних животных для здоровья человека


    Животные играют важную роль в жизни многих людей. Помимо собак-поводырей и собак, которых можно обучить обнаруживать припадки, животных также можно использовать в профессиональной терапии, логопедии или физической реабилитации, чтобы помочь пациентам выздороветь. [1] Помимо этих назначенных терапевтических ролей, животные также ценятся как компаньоны, что, безусловно, может повлиять на качество нашей жизни. Полезно ли это общение для нашего здоровья?

    Чем лучше мы понимаем связь человека и животного, тем больше мы можем использовать ее для улучшения жизни людей.В этой статье кратко излагается, что известно и неизвестно о том, как животные помогают улучшить здоровье и благополучие людей, и каковы могут быть последствия для помощи людям, у которых нет собственных домашних животных. Более 71 миллиона американских семей (62%) имеют домашних животных, [2] , и большинство людей думают о своих домашних животных как о членах семьи. [3] Некоторые исследования показали, что люди, у которых есть домашнее животное, имеют более здоровое сердце, реже остаются дома больными, реже посещают врача, больше занимаются физическими упражнениями и меньше подвержены депрессии.Домашние животные также могут оказывать значительное влияние на аллергию, астму, социальную поддержку и социальные взаимодействия с другими людьми.

    Влияние на физическое здоровье

    Животные-компаньоны могут улучшить здоровье сердца за счет снижения кровяного давления и регулирования частоты сердечных сокращений во время стрессовых ситуаций. В исследовании 2002 года исследователи измерили изменения частоты сердечных сокращений и артериального давления у людей, у которых была собака или кошка, по сравнению с теми, у кого их не было, когда участники находились в состоянии стресса (выполняя рассчитанное на время математическое задание).У людей с собакой или кошкой в ​​начале эксперимента была более низкая частота сердечных сокращений и показатели артериального давления, чем у владельцев животных. У людей с собакой или кошкой также меньше шансов иметь скачки сердечного ритма и артериального давления при выполнении математической задачи, и их частота сердечных сокращений и артериальное давление быстрее возвращаются в норму. Они также делают меньше ошибок в математике, когда их питомец был присутствует в комнате. [4] Все эти результаты показали, что наличие собаки или кошки снижает риск сердечных заболеваний, а также снижает уровень стресса, так что производительность улучшается.

    Аналогичное исследование показало, что присутствие вашей собаки в комнате снижает артериальное давление лучше, чем прием популярных лекарств от кровяного давления (ингибитор АПФ), когда вы находитесь в состоянии стресса. [5] Другие исследования показали, что простое поглаживание домашнего животного может помочь снизить кровяное давление и уровень холестерина. [6]

    Контакт детей с домашними животными также может снизить тревожность. Например, в одном исследовании измеряли артериальное давление, частоту сердечных сокращений и поведенческий дистресс у здоровых детей в возрасте от 3 до 6 лет во время двух разных посещений врача для обычных медицинских осмотров.При одном посещении в комнате присутствовала собака (не связанная с ребенком), а при другом посещении собака отсутствовала. Когда собака присутствовала, у детей были более низкие показатели артериального давления, более низкая частота сердечных сокращений и меньше поведенческих расстройств. [7] Однако исследования о пользе для здоровья от взаимодействия детей и животных все еще ограничены. Необходимы дальнейшие исследования того, как домашние животные влияют на развитие ребенка и конкретные результаты для здоровья.

    Результаты показывают, что социальная поддержка, которую оказывает домашнее животное, может сделать человека более расслабленным и снизить стресс. [8] Социальная поддержка со стороны друзей и семьи может иметь аналогичные преимущества, но межличностные отношения также часто вызывают стресс, тогда как домашние животные могут с меньшей вероятностью вызвать стресс. Социальная поддержка, оказываемая домашним животным, также может стимулировать большее социальное взаимодействие с людьми, уменьшая чувство изоляции или одиночества. Например, было обнаружено, что прогулка с собакой увеличивает социальное взаимодействие, особенно с незнакомцами, по сравнению с прогулкой без собаки. [9]

    Среди пожилых людей владение домашними животными также может быть важным источником социальной поддержки, повышающей их благополучие.В одном исследовании пожилые люди, у которых была собака или кошка, были лучше способны выполнять определенные физические действия, считающиеся «повседневными делами», например способность подниматься по лестнице; наклониться, стать на колени или наклониться; принимать лекарства; готовить еду; и купаться и одеваться. Между владельцами собак и кошек не было значительных различий в их способностях выполнять эти действия. Ни продолжительность жизни собаки или кошки, ни уровень привязанности к животному не влияли на работоспособность.Похоже, что животные-компаньоны не влияют на психологическое здоровье, но исследователи предположили, что заботливая роль может дать пожилым людям чувство ответственности и целеустремленности, что способствует их общему благополучию. [10]

    В крупном немецком исследовании была собрана информация о домашних животных (собаках, кошках, лошадях, рыбах, птицах или других домашних животных) от более чем 9000 человек в два разных периода (1996 и 2001). Опрос включал ряд вопросов, касающихся здоровья, экономики и труда, поэтому респонденты не осознавали интерес исследователей к связи между домашними животными и здоровьем.Исследователи обнаружили, что люди, которые сказали, что у них было домашнее животное, в 1996 и 2001 годах, имели меньше всего посещений врача, за ними следовали люди, которые приобрели домашних животных к 2001 году; группа людей, у которых не было домашних животных, имела наибольшее количество посещений врача. [11] Точно так же исследование женщин в Китае показало, что те, кто были владельцами собак, меньше посещали врача, брали меньше выходных из-за болезни и тренировались чаще, чем владельцы собак. [12]

    Исследования аллергии и астмы неоднозначны.Некоторые исследования показывают, что наличие кошки может повысить чувствительность к аллергенам, в то время как другие показывают, что это может защитить от аллергии на кошек. Наличие собаки может не повлиять на конкретную собачью аллергию или защитить от нее. [13] Исследование, проведенное в 2013 году, показало, что мыши были защищены от аллергии, когда подвергались воздействию пыли, исходящей из домов с собаками. [14] Исследователи обнаружили, что защитный эффект был обусловлен определенным типом кишечных бактерий, которые часто присутствуют у людей с собаками.Необходимы дополнительные исследования связи между аллергией, астмой и домашними животными, но возможно, что влияние наличия домашних животных на аллергию может зависеть от возраста человека на момент контакта с животным, а также от типа домашнее животное. Например, у 6-7-летних детей, которые жили с птицей в течение первого года жизни, чаще наблюдались респираторные симптомы, такие как хрипы, по сравнению с детьми, у которых в младенчестве не было птицы в доме. [15] Точно так же исследователи говорят, что время, когда домашнее животное находится в семье, также важно.У детей с собаками или кошками в доме в течение первого года жизни меньше вероятность развития аллергии в детстве. [6]

    Как и любые отношения, некоторые отношения между человеком и домашним животным, вероятно, будут более полезными, чем другие. Некоторые люди привязаны к своим домашним животным больше, чем другие, и эти чувства могут повлиять на то, как животное влияет на их здоровье. Другие факторы, такие как пол и семейное положение, могут играть роль. Например, одно исследование показало, что владение собакой было связано с более низким уровнем депрессии среди женщин, но не среди мужчин, и среди одиноких, но не женатых людей.Таким образом, хотя владение домашним животным может положительно сказаться на благополучии некоторых людей, оно не влияет на всех одинаково. [16]

    Эмоциональное развитие детей

    Исследования показывают, что когда у ребенка нет братьев или сестер, домашние животные помогают детям развивать сочувствие, повышать самооценку и активнее участвовать в общественной и физической активности. [6]

    Проблемы измерения положительного воздействия домашних животных

    Влияние взаимодействия человека и животного на здоровье до конца не изучено, так как его сложно изучить.Большинство доказательств преимуществ наличия домашнего животного получено из опросов о текущем состоянии здоровья, но это означает, что невозможно узнать, находится ли человек в добром здравии, потому что у него есть домашнее животное, или у него больше шансов завести домашнее животное, потому что он находится в состоянии здоровья. хорошее здоровье. Человек с плохим здоровьем может решить, что у него нет времени или сил для ухода за домашним животным. Немецкое исследование, описанное выше, предполагает, что наличие домашнего питомца в течение более длительного периода времени более полезно для вашего здоровья; но также возможно, что у людей с домашними животными меньше времени, чтобы пойти к врачу, или они меньше беспокоятся о собственном здоровье, особенно о незначительных недугах.

    Кроме того, люди, которые любят своих питомцев, скорее всего, захотят сообщить исследователям, что их питомцы помогают улучшить их жизнь. Это может исказить результаты исследования.

    Другой вопрос, как определяется слово «домашнее животное». Имеет ли золотая рыбка ту же пользу для здоровья, что и золотистый ретривер? Большинство исследований домашних животных проводилось на людях, у которых были собаки или кошки, что затрудняло выводы о пользе для здоровья птиц, ящериц, рыб или других домашних животных. Сколько времени человек проводит со своим домашним животным, может сильно зависеть от типа домашнего животного и, в свою очередь, может повлиять на пользу для здоровья от наличия домашнего животного. [17]

    Временные компаньоны

    Исследователи также использовали животных для временного общения с детьми с проблемами здоровья или психического здоровья, а также с пожилыми людьми, у которых может не хватать энергии или ресурсов для проживания домашнего питомца. Хотя эти исследования не всегда дают согласованные результаты, некоторые положительные результаты взаимодействия с терапевтической собакой включают снижение уровня боли и беспокойства среди госпитализированных детей и взрослых, а также повышение внимания и взаимодействия между детьми с аутизмом и другими нарушениями развития.В домах престарелых взаимодействие с посещающими собаками привело к большему социальному поведению, большему взаимодействию между обитателями и меньшему одиночеству. [18]

    Хотя исследования взаимодействия с животными и терапии не всегда последовательны и часто проводятся с небольшими группами участников, есть некоторые свидетельства

    .

    Выделение и структурная идентификация флавоноидов

    Флавоноиды, которые имеют основной фенил-бензопироновый скелет C15, относятся к серии соединений, в которых два бензольных кольца (кольцо A и B) связаны друг с другом через три атома углерода. Основываясь на структуре ядра, флавоноиды можно разделить на разные классы флавоноидов, такие как флавонолы, флавоны, флаваноны, флаванонолы, антоцианидины, изофлавоны и халконы. Флавоноиды часто гидроксилированы в положениях 3, 5, 7, 3 ', 4' и / или 5 '.Часто одна или несколько из этих гидроксильных групп метилированы, ацетилированы, пренилированы или сульфатированы. В растениях флавоноиды часто присутствуют в виде О- или С-гликозидов. О-гликозиды имеют сахарные заместители, связанные с гидроксильной группой агликона, обычно расположенные в положении 3 или 7, тогда как C-гликозиды имеют сахарные группы, связанные с углеродом агликона, обычно 6-C или 8-C. Наиболее распространенные углеводы - это рамноза, глюкоза, галактоза и арабиноза. В этой главе в основном представлены методы выделения и структурной идентификации флавоноидов.

    .

    Изоляция экологических бактерий из поверхностных источников и питьевой воды в Мафикенге, Южная Африка, и характеристика с использованием их профилей устойчивости к антибиотикам

    Целью этого исследования было изолировать и идентифицировать экологические бактерии из различных источников сырой воды, а также из системы распределения питьевой воды в Мафикенге, Южная Африка, и определить их профили устойчивости к антибиотикам. Пробы воды из пяти разных мест (сырая и питьевая вода) были проанализированы на наличие фекальных индикаторных бактерий, а также на наличие видов Aeromonas и Pseudomonas .Фекальные и общие колиформные бактерии были обнаружены летом в пробах обработанной воды с плотины Модимола и в пробах смешанной воды с Pseudomonas spp. являясь наиболее распространенным организмом. Наиболее распространенным наблюдаемым фенотипом множественной устойчивости к антибиотикам был KF-AP-C-E-OT-K-TM-A. Все протестированные организмы были устойчивы к эритромицину, триметоприму и амоксициллину. Все изоляты были чувствительны к ципрофлоксацину, фекальным колиформным бактериям и Pseudomonas spp. к неомицину и стрептомицину.Кластерный анализ, основанный на данных о диаметре зоны ингибирования, позволяет предположить, что изоляты имели сходную историю химического воздействия. Изоляты идентифицировали с использованием gyrB , toxA, ecfX, aerA, и фрагментов гена hylH и амплифицировали фрагменты gyrB , ecfX, и hylH . Эти результаты демонстрируют, что (i) питьевая вода из Мафикенга содержит различные виды бактерий, а иногда и фекальные и общие колиформные бактерии. (ii) Различные бактерии устойчивы к различным классам антибиотиков.

    1. Введение

    Вода считается средством размножения и распространения бактерий, ассоциированных с человеком [1]. Безопасная питьевая вода является одним из основных прав человека, и если она заражена условно-патогенными экологическими бактериями, она может иметь последствия для здоровья потребителей [2, 3]. Поэтому здоровье человека следует защищать путем предотвращения микробного заражения воды, предназначенной для потребления [4]. В сельских общинах неочищенная поверхностная вода из рек, плотин и ручьев напрямую используется для питья и других бытовых целей [5].Эти незащищенные источники воды могут быть заражены микробами из-за дождевых стоков и сельскохозяйственных ресурсов, смешиваясь со сточными водами и фекалиями дикой природы [6, 7], что делает их неприемлемыми для потребления человеком. Фекальные колиформные бактерии, Aeromonas и Pseudomonas, используются в качестве индикаторов фекального загрязнения воды [8], и присутствие этих патогенов может иметь серьезные последствия для здоровья потребителей, особенно с ослабленным иммунитетом [5, 9, 10].

    Южная Африка - полузасушливая страна с очень низким количеством осадков и высоким испарением [11], и в ней не хватает систем пресной воды из-за очень изменчивого и пространственного распределения осадков [12]. Более того, безопасная питьевая вода часто используется для неприемлемых видов питья, таких как орошение, смыв туалета и мочи [12], а также общая уборка. Для управления существующими водными ресурсами и решения некоторых проблем, связанных с нехваткой воды в Южной Африке и в мире в целом, повторное использование сточных вод может стать важным компонентом управления спросом на воду [13], но такое повторное использование сточных вод может повлиять на качество питьевой воды при отсутствии надлежащих процедур очистки.В то время как повторное использование сточных вод широко внедряется в некоторых европейских и африканских странах [13], однако в Южной Африке задокументировано лишь несколько схем повторного использования сточных вод [14, 15], и реализация этой альтернативы в общинах ограничена.

    Сообщалось о тревожном росте потребления антибиотиков в терапии людей и сельскохозяйственных процессах [16, 17], и такое широкое использование в медицине человека и животных привело к развитию устойчивых к антибиотикам бактерий, которые влияют на лечение инфекций [ 18, 19].Поэтому устойчивость к антибиотикам стала серьезной проблемой общественного здравоохранения [20], и ее присутствие в сточных водах, поверхностных водах и питьевой воде хорошо задокументировано [19–22]. Опасность, связанная с патогенностью микробов, усугубляется их способностью противостоять уничтожению антибиотиками. Процессы биологической очистки на станциях очистки сточных вод могут привести к селективному увеличению числа устойчивых к антибиотикам бактерий и, следовательно, к увеличению числа организмов с множественной лекарственной устойчивостью [23].Хотя количество микроорганизмов в питьевой воде уменьшается за счет хлорирования, они могут выжить в процессе очистки и попасть в систему распределения [1]. Более того, ранее сообщалось о наличии устойчивости к антибиотикам у микроорганизмов [24–26]. Учитывая тот факт, что общественное здоровье сообщества может быть связано с качеством подаваемых очищенных сточных вод и что общественное здоровье можно защитить за счет уменьшения количества патогенных микроорганизмов в питьевой воде, настоящее исследование было разработано для изоляции бактерий окружающей среды с поверхности и питьевой воды. воды в Мафикенге и идентифицировать виды Pseudomonas и Aeromonas с помощью полимеразной цепной реакции (ПЦР).Еще одна цель состояла в том, чтобы охарактеризовать изоляты с использованием их профилей устойчивости к антибиотикам.

    2. Материалы и методы
    2.1. Район исследования

    Пробы воды были собраны в пяти точках отбора проб вокруг Мафикенга, а именно, как сырая, так и очищенная (питьевая) вода из карстового источника подземных вод, Глаз Молопо, как сырая вода, так и очищенная (питьевая) вода из плотины Модимола, и наконец, смешанная вода, очищенная вода из обоих источников смешалась в резервуаре Сигнал-Хилл и распространилась по некоторым районам города.Эти точки отбора проб были выбраны для исследования, потому что вода из Молопо-Ай и плотины Модимола после очистки используется для потребления людьми, а также для рекреационных, сельскохозяйственных и промышленных целей. Поскольку рядом с этими двумя водными ресурсами проживает небольшое количество мелких фермеров, а дамба Модимола принимает очищенные сточные воды от очистных сооружений Ммабато, которые являются основным источником патогенов, поэтому важно исследовать микробиологическое качество воды в этих точках.

    2.2. Отбор проб

    Пробы сырой и очищенной воды отбирались в течение одного года, в феврале, апреле, июле и октябре, чтобы охватить четыре различных сезона. Образцы воды из глаз Молопо и плотины Модимола были собраны в стерильных стеклянных бутылках Duran Schott объемом 500 мл из различных точек отбора проб путем непосредственного погружения бутылок на поверхность воды. Пробы очищенной воды собирали непосредственно в стерильные бутылки из-под крана после того, как кран работал в течение минуты.Образцы были должным образом промаркированы и доставлены на льду в лабораторию для анализа. Аликвоты образцов использовали для селективного выделения фекальных колиформ, общих колиформ, Aeromonas , Pseudomonas, и гетеротрофных бактерий на основе стандартных микробиологических процедур [27].

    2.3. Выделение, очистка и характеристика планктонных бактерий
    2.3.1. Выделение мембранной фильтрацией

    Для всех образцов три объема по 100 мл были отфильтрованы через 0.45 мкм Фильтр с размером пор м (мембраны из нитрата целлюлозы, лаборатория Whatman Division, Мейдстон, Англия) с использованием водяного насоса (модель Sartorius 16824). Эти мембраны в асептических условиях помещали на планшеты с подходящей селективной средой, гарантируя отсутствие пузырьков воздуха. Используемые селективные среды следующие. Агар mFC, используемый в качестве селективной среды для фекальных колиформ, mEndo для общих колиформ, питательный агар для гетеротрофных бактерий и селективная среда Aeromonas для Aeromonas и Pseudomonas (Biolab, Merck, Южная Африка).Все среды были приготовлены в соответствии с инструкциями производителей (Biolab, Merck, Южная Африка). Каждый образец анализировали в трех экземплярах. Для выделения гетеротрофных бактерий 1 мл обработанных образцов воды наносили на чашки с питательным агаром. Образцы воды из Modimola dam и Molopo eye были серийно разбавлены и 1 мл 5-кратных серийных разведений был нанесен на чашки с питательным агаром.

    Планшеты инкубировали при 37 ° C, за исключением агара mFC, который инкубировали при 45 ° C в течение 24 часов.Колонии были подсчитаны, охарактеризованы и зарегистрированы. Результаты были выражены как количество фекальных колиформ, общих колиформ, Pseudomonas и Aeromonas в 100 мл воды и гетеротрофных бактерий в 1 мл воды. Синие колонии из агара mFC (предположительные колиформные бактерии), колонии с металлическим блеском из агара mEndo (предполагаемые общие колиформные бактерии), а также желтые (предположительно Aeromonas ) и зеленые колонии (предположительно Pseudomonas ) из селективных сред Aeromonas были отобраны для дальнейшей работы ( Каталог Биолаборатории).

    2.3.2. Очистка колоний

    Колонии очищали путем двукратного субкультивирования с использованием метода штриховой пластинки. Молодые культуры использовали для окрашивания по Граму, и все изоляты были идентифицированы как грамотрицательные бациллы. Все грамотрицательные изоляты подвергались первичным и вторичным биохимическим идентификационным тестам. Бактерии, которые были отобраны для создания антибиотиков, наносили штрихами на скошенный питательный агар для получения культур образцов и для целей ПЦР.

    2.4.Тест на чувствительность к противомикробным препаратам

    Тест на чувствительность к антибиотикам проводили с использованием метода дисковой диффузии Кирби-Бауэра [28]. Использовали следующие диски с антибиотиками (Mast Diagnostics, UK) в указанных конечных концентрациях: ампициллин (AP) -10 мкг г, цефалотин (KF) 5 мкг г, стрептомицин (S) 10 мкг г , эритромицин (E) 15 μ г, хлорамфеникол (C) 30 μ г, неомицин (NE) 30 μ г, амоксициллин (A) 10 μ г, ципрофлоксацин (CIP) 5 μ г , триметоприм (TM) 25 μ г, канамицин (K) 30 μ г и окситетрациклин (OT) 30 μ г.Эти антибиотики были выбраны потому, что они либо используются как в медицине, так и в ветеринарии животных, либо потому, что в предыдущих исследованиях сообщалось о резистентности к ним микробов [29].

    Три колонии отбирали из каждого образца, и каждую колонию переносили в 3 мл стерильной дистиллированной воды для приготовления бактериальной суспензии. Аликвоты по 100 мкл, л из каждой суспензии помещали на чашки с агаром Мюллера-Хинтона. Диски с антибиотиками наносили на планшеты с помощью стерильных игл, и планшеты инкубировали при 37 ° C в течение 24 часов [30].После инкубации измеряли диаметры зоны ингибирования антибиотика (IZD). Полученные результаты были использованы для классификации изолятов как устойчивых, промежуточно устойчивых или чувствительных к определенному антибиотику с использованием стандартных эталонных значений в соответствии с Национальным комитетом по клиническим лабораторным стандартам [30], ныне Институт клинических и лабораторных стандартов (CLSI). Фенотипы множественной устойчивости к антибиотикам (MAR) были созданы для изолятов, которые показали устойчивость к 3 или более антибиотикам.

    2.5. Тесты первичной идентификации
    2.5.1. Тест с тройным сахарным железом (TSI)

    Агар с тройным сахарным железом (TSI) - это дифференциальная среда, полученная от Biolab, Merck (Южная Африка), с субстратами глюкозы, сахарозы и лактозы при концентрациях образца 0,1, 1,0 и 1,0%. соответственно. Он может различать ряд грамотрицательных кишечных бактерий на основе их физиологической способности (или ее отсутствия) метаболизировать лактозу и / или сахарозу, проводить ферментацию с образованием кислоты, выделять газ во время ферментации и генерировать H 2 S.Среды были приготовлены в соответствии с инструкциями производителя. Аликвоты помещали в пробирки и автоклавировали. После выхода из автоклава пробирки помещали на штатив и зажимали так, чтобы пробирки (с жидкой средой в них) имели наклон 3 см с торцом от 2 до 3 см. Им дали остыть, пока они не станут твердыми. В косяки засевают чистую культуру путем нанесения штрихов по всей поверхности наклона (зигзагообразно, чтобы покрыть поверхность), а затем вонзания глубоко в стык.Инкубация проходила при 37 ° C в течение 24 часов. Если сбраживается только глюкоза, в ягоде образуется кислота, и он становится желтым. Однако, если ферментируется сахароза или лактоза, образуется достаточно продуктов ферментации, чтобы пожелтеть и то, и другое. Если во время ферментации образуется газ, он будет отображаться на стыке либо в виде пузырьков, либо в виде растрескивания агара. Если брожение не происходит, скос и стык останутся красными. Среда также содержит сульфат железа. Если бактерия образует H 2 S, это химическое вещество будет реагировать с железом с образованием сульфида железа, который отображается в виде черного осадка на стыке (черный стык).

    2.5.2. Оксидазный тест

    Этот тест проводился с использованием тестового оксидазного реагента (PL.390) от Mast Diagnostics (Nesto, Wirral, UK) в соответствии с опубликованным протоколом производителя. Хорошо изолированную чистую колонию помещали на фильтровальную бумагу с помощью стерильной проволочной петли. К нему добавляли каплю реактива тест-оксидазы и перемешивали. Через 30 секунд на фильтре наблюдали изменение цвета с оксидазоположительными изолятами, дающими пурпурный цвет, которые принимали как предполагаемые изоляты Aeromonas и Pseudomonas .Отрицательные по оксидазе колонии были бесцветными и предположительно считались E. coli .

    2.6. Вторичные идентификационные тесты
    2.6.1. Индекс аналитического профиля (API) 20E Test

    Тест API 20E был выполнен в соответствии с протоколом производителя (BioMérieux, 69280, Marcy I’Etoile, Франция), и организмы были идентифицированы до уровня вида с использованием программного обеспечения API.

    2.6.2. Гемолиз на кровяном агаре

    Гемолиз на кровяном агаре (Biolab, Merck, SA) с добавлением 5% (об. / Об.) Овечьей крови определяли после инкубации планшетов при 37 ° C в течение 24 часов.Гемолиз определяют путем выделения штрихов на чашке с кровяным агаром. После инкубации в течение ночи среду проверяют на наличие признаков альфа- или бета-гемолиза. Если после роста среда изменила цвет или потемнела, в организме обнаружен альфа-гемолиз. Если при росте в среде появляется четкий ореол, организм является бета-гемолитическим. Отсутствие заметного изменения цвета среды свидетельствует о гамма-гемолизе.

    2.7. Экстракция геномной ДНК и ПЦР для идентификации видов культур.
    ДНК

    из изолятов экстрагировали с использованием набора для экстракции бактериальной ДНК peqGOLD (PEQLAB Biotechnologie GmbH 12-3450) в соответствии с протоколом производителя.Концентрацию экстрагированной ДНК в растворе определяли спектрофотометрически (NanoDrop ND 1000, Thermo Scientific, США). Целостность очищенной матричной ДНК оценивали с помощью обычного 1% (мас. / Об.) Агарозного геля.

    2.7.1. Идентификация изолятов с помощью ПЦР

    Идентичность предполагаемых Pseudomonas была подтверждена с помощью ампликонов фрагментов гена gyrB 222 [31], toxA 367 [32] и ecfX 528 [33] соответственно. .Идентичность видов Aeromonas была определена путем скрининга их на наличие специфических вирулентных генов аэролизина ( aerA ) [34] и гемолизина ( hylH ) [35]. ПЦР

    выполняли с использованием комбинаций олигонуклеотидных праймеров и условий цикла, которые представлены в таблицах 1 и 2. Амплификации выполняли с использованием термоциклера Пельтье (модель-PTC-220DYAD DNA ENGINE, MJ Research Inc., США). Реакции готовили в 25 объемах мкл л, которые составляли 1 мкл г / мкл мкл матричной ДНК, 50 пмоль каждого набора олигонуклеотидных праймеров, 1x мастер-смесь для ПЦР и воду, свободную от РНКазы.Все использованные реагенты для ПЦР были Fermentas, США, продукты, поставленные Inqaba Biotechnological Industries Pty Ltd., Претория, Южная Африка. Все продукты ПЦР хранили при 4 ° C до использования для дальнейшего анализа.

    9017 9017 ECF ECF 398
    GyrPA-620

    Праймер Олигонуклеотидная последовательность (5'-3 ') Мишень и размер (pb) Условия цикла ПЦР
    ECF ATGGATGAGCGCTTCCGTG
    TCATCCTTGCCTCCCTG
    ecfX, (528) 35X 94 ° C в течение 45 секунд
    58 ° C в течение 45 секунд
    72 ° C
    CCTGACCATCCGTCGCCACAAC
    CGCAGCAGGATGCCGACGCC
    gyrB, (222) 35X 94 ° C в течение 45 с
    66 ° C в течение 1 9178
    ETA1
    ETA2
    GACAACGCCCTCAGCATCACCAGC
    CGCTGGCCCATTCGCTCCAGCGCT
    toxA, (367) 35X 94 ° C в течение 45 с
    9 0003 66 ° C в течение 45 с
    72 ° C в течение 1 м

    Начальная денатурация 95 ° C в течение 5 минут и конечное удлинение пряди 72 ° C в течение 5 минут.
    aer A

    Гены Олигонуклеотидная последовательность (5'-3 ') Целевой ген и размер (п.о.)
    Aer 2F: AGCGGCAGAGCCCGTCTATCCA
    Aer 2R: AGTTGGTGGCGGTGTCGTAGCG
    aerA (416) 30X 95 ° C для 2 м (416) 30X 95 ° C для 2 м
    9000 ° C для 2 м

    hyl H Hyl 2F: GGCCCGTGGCCCGAAGATGCAGG
    Hyl 2R: CAGTCCCACCCACTTC
    м3 для м3 для м3 для м3 для м
    72 ° C на 1 м

    Начальная денатурация 95 ° C в течение 5 минут и окончательное удлинение пряди 72 ° C в течение 7 мин.
    2.7.2. Электрофорез продуктов ПЦР

    Продукты ПЦР разделяли электрофорезом в 2% (мас. / Об.) Агарозном геле. Электрофорез проводили в горизонтальной системе оборудования Pharmacia Biotech (модель Hoefer HE 99X; Amersham Pharmacia Biotech, Швеция) в течение 2 ч при 60 В с использованием 1x буфера TAE (40 мМ Трис, 1 мМ EDTA и 20 мМ ледяной уксусной кислоты, pH 8,0. ). Каждый гель содержал маркер молекулярной массы ДНК размером 100 п.н. (Fermentas, США). Гель окрашивали бромидом этидия (0.1 мкг г / мл) в течение 15 мин, и ампликоны визуализировали в УФ-свете. Систему Gene Genius Bioimaging (Syngene, Synoptics, UK) использовали для захвата изображения с помощью программного обеспечения GeneSnap (версия 3.07.01) (Syngene, Synoptics, UK).

    2,8. Статистический анализ

    Кластерный анализ, основанный на данных о диаметре зоны ингибирования антибиотиком различных организмов, выделенных из разных участков, был определен с использованием алгоритма Варда и Евклидова расстояния программы Statistica версии 7.

    3.Результат
    3.1. Встречаемость бактерий группы кишечной палочки и видов Aeromonas и Pseudomonas в воде

    Основная цель этого исследования заключалась в определении уровней бактерий в окружающей среде из источника и питьевой воды из Мафикенга. Сырая вода из плотины Модимола и глаз Молопо, очищенная вода из этих двух участков и смешанная вода были проанализированы на наличие общих колиформ, фекальных колиформ, гетеротрофных бактерий и видов Aeromonas и Pseudomonas .В таблице 3 показано среднее количество различных организмов, изолированных из разных участков летом и зимой. Гетеротрофные бактерии были изолированы на всех участках отбора проб в оба сезона, и их встречаемость была высокой. Более того, видов Pseudomonas , фекальные и общие колиформные бактерии были наиболее распространенными в течение всех сезонов как в сырой, так и в очищенной воде с плотины Модимола. Однако видов Aeromonas были выделены только из проб сырой воды, а не из очищенной воды со всех участков.Число выделенных организмов летом было больше, чем зимой.

    .

    Смотрите также